Introduction

GM crops evolved the agriculture by improving the crop productivity to ensure adequate food supply, enhanced nutritional quality, taste, resistance to herbicides, pests, increased shelf life etc. (Napier et al. 2019; Mbabazi et al. 2021). The first GM plant (Nicotiana tabacum) was developed in 1983 with antibiotic resistance trait (Woolsey 2012). Currently, GM crops are being cultivated on an area of approximately 190 million hectares in the world, with GM cotton, corn and soybean are being the prominent crops (Turnbull et al. 2021). Numerous studies have documented an expansion in the development of the R&D sector for GM crops (Graff et al. 2009; Miller and Bradford 2010). The GM corn has more approved events than any other transgenic crop. It was planted around the globe at 53.6 million hectares in 2015 which was about one-third of the total cultivated area with global net worth of transgenic corn is 8.1 billion US dollars (Pellegrino et al. 2018).

The cultivation of GM corn has not yet been approved in Pakistan. A comprehensive biosafety study to assess any of its potential effects is pre-requisite for commercialization. Centre of Excellence in Molecular Biology (CEMB), University of the Punjab-Pakistan has developed a Bt transgenic corn event expressing two Cry toxins (Cry1Ac & Cry2A) and is in pipeline for the commercialization. Possible risks associated with the GM food could be allergenicity (Gabol et al. 2012), harmful effect on non-targeted organisms (Losey et al. 1999), adverse health effects on the experimental animals (Sánchez and Parrott 2017) and any hematological, immunologic and biochemical effect (Dona and Arvanitoyannis 2009). Inconsistent reports and contradictory opinions regarding the possible dangers of GM crops to human health further sensitize the risks associated with GM crops. Moreover, non-availability of authentic information regarding the legitimacy of safety assessment tests pose bottleneck in consumer acceptance towards GM foods (Ibrahim and Okasha 2016).

The current biosafety study was designed on broiler chicken that were fed with CEMB-Bt corn in varied concentrations to assess any potential risk associated with the CEMB-Bt corn. After feeding diet containing CEMB-Bt corn, different health related parameters; feed consumption, serum biochemistry, immune and growth-related genes expression were evaluated. Corn is the basic ingredient of poultry feed, therefore chickens were selected in the current study (Anami and Widanarti 2020). In Pakistan, consumption of total annual grain in commercial poultry industry is estimated at 4.23 million tons out of which 2.42 million tons (57%) is met from corn (Habib et al. 2016). Moreover, the broiler chicken has high tendency of gain weight, making them highly responsive to any modification or toxins associated with diet.

Materials and Method

Test material

The test substance was genetically modified corn event, CEMB-Bt corn. Two insecticidal Cry toxin genes (cry1Ac & cry2A) derived from Bacillus thuringenesis were codon optimized for enhanced expression in maize. The illustration of the binary construct harboring cry genes is depicted as Fig. 1.

Confirmation of Bt gene insertion in CEMB Bt-corn event

The insecticidal Cry toxin genes; cry1Ac and cry2A were expressed as a single T-DNA insertion in the transgenic event, hence transgene insertion could be achieved either through cry1Ac or cry2A gene amplification (Lee and Gelvin 2008). For this, genomic DNA was extracted from the seeds of GM and non-GM corn samples through the modified CTAB method. A 2X CTAB buffer (2% CTAB, 1% PVP, 1.4 M NaCl, 100 mM Tris HCl pH 8.0, 20 mM EDTA pH 8.0 and H₂O) and extraction Buffer (20 mM Tris HCl pH 8.0, 25 mM EDTA pH 8.0, 200 mM NaCl, 0.5% SDS and H₂O) was heated at 65℃ in the water bath prior to extraction. A 100 mg seed sample was ground in 600 μL pre-heated extraction buffer. The mixture was transferred to a tube and 400 μL of 2X CTAB buffer along with 5 μL of β-Mercaptoethanol, samples were vortexed for 1 to 2 min. Then samples were incubated at 65^oC in the water bath for 1 h accompanied by occasional shaking. Samples were cooled down on the ice for 5 min and added the 400 μL of chilled Chloroform: Isoamyl alcohol (24:1). Later, the samples were centrifuged at 13000 rpm for 20 min at 4^oC. The supernatant was shifted to a new tube and 2/3 volume of ice-cold isopropanol was added and mixed by inversions. The samples were incubated for 1 h at -20^oC and later centrifuged at 13000 rpm for 15 min at 4^oC. The supernatant was removed and the pellet was washed with 500 μL of 70% Ethanol (Merk). The DNA pellet was air-dried and resuspended in the 30 μL of nuclease free water. The DNA was treated with 0.5 μL RNAse (10 mg/mL) to remove any RNA.

PCR amplification for transgene insertion

PCR amplifications were performed to reveal insertion of cry genes in CEMB inbred corn line. The gene specific primers (Table 1) were used for amplification. Genomic DNA isolated from non-GM corn seeds was used as negative control while for positive control; binary construct containing cry genes was used. The PCR reaction mixture contained 100 ng of DNA template, 1X PCR Buffer, 2.5 mM MgCl₂, 0.2 mM dNTPs mix, 1 µM of each forward and reverse primer, 0.5 units of Taq DNA polymerase (Thermo Scientific) and nuclease free water to make volume up to 20 µL. The amplification was performed in Veriti thermal cycler (ABI) and the conditions were; denaturation at 94^oC for 5 min followed by 35 cycles of denaturation at 95^oC for 30 sec, annealing at 60^oC for 30 sec and extension at 72^oC for 1 min. Final extension was at 72^oC for 10 min and amplified products were resolved on 1% agarose gel at 80 volts for 15–20 min.

Diet Formulation for in-vitro feeding assay

For feeding of the subjected birds, four different diets based on corn seed content by mixing defined quantity of non-GM and CEMB-Bt transgenic corn. The diet formulation for control and experimental groups were prepared as described by Hameed et al. (2016) with slight modifications. In the control group, the chickens were fed 50% non-GM corn and 50% commercial feed. While the experimental group, labeled as T50, T40 and T30 contained 50, 40 and 30% of CEMB-Bt corn, respectively in addition to 50% commercial feed (Table 2). Each diet formulation was ground to form porridge.

Nutritional analysis of diets

The diet formulations were analyzed for their nutritional contents from Provincial Animal Research Laboratory affiliated with Veterinary Research Institute, Lahore-Pakistan. Three random samples from each diet were used for analysis as biological replicates. The various dietary parameters (dry matter, crude protein, crude fat, crude fiber, ash, phosphorus, Nitrogen-Free Extract (NFE) starch and soluble sugars) were measured.

Enzyme Linked Immunosorbent Assay (ELISA) to measure Cry toxins (Cry1Ac and Cry2A) in CEMB-Bt corn

ELISA technique was used to measure the concentration of Cry toxin in all four diets (T30, T40, T50 and control). Table 1: List of the primers used for Quantitative Real-Time PCR

Primers name	Primer Sequence 5' to 3'	Annealing temperature (^oC)	Product size (bp)	Accession No.
Bt gene
Bt	F: ATCTTCACCTCAGCGTGCTT	62	769bp
	R: GGTGGCACATTGTTGTTCTG
Major Growth-Related Gene
IGF-I	F: GGTGCTGAGCTGGTTGATGC	58	203	JN942578
	R: CGTACAGAGCGTGCAGATTTAGGT
IGF-II	F: GGCGGCAGGCACCATCA	58	215	JN942579
	R: CCCGGCAGCAAAAAGTTCAAG
cGH	F: CACCACAGCTAGAGACCCACATC	58	201	HE608816
	R: CCCACCGGCTCAAACTGC
*Mucin* Gene
Muc-	F: CTGGCTCCTTGTGGCTCCTC	58	242	JN639849
	R: AGCTGCATGACTGGAGACAACTG
Immune Response Gene
IL-2	F: CCCGTGGCTAACTAATCTGCTG	57	287	HE608819
	C: TGAGACACCAGTGGGAAACAGT
TLR-04	F: GTTCCTGCTGAAATCCCAAACACC	58	239	NC_006104.5
	R: GCCAAGAGCCACGAGACTCCAAA
TLR-15	F: GTGAGAATGGGCTGGTACTGGTG	58	203	NC_006090.5
	R: CCAAGTACAGGATGCCCTGGT
IL- 1β	F: CATGTCGTGTGTGATGAGCGG	57	208	AJ245728
	R: GCTGTCCAGGCGGTAGAAGATGAA
iNOS	F: GTGTTGTGTGCTTCCACTGC	59	215	NC_006106.5
	R: AACACCTCCAAAGCCCTAGC
Reference Gene
28s	F: CAGGTGCAGATCTTGGTGGTAGTA	58	273	JN639848
	R: GCTCCCGCTGGCTTCTCC

Note: Bt (Bacillus Thuringiensis; cry1Ac and cry2A genes) IGF (Insulin-like Growth factor), GH (chicken Growth Hormone), Muc (mucin), IL (interleukin), iNOS (inducible Nitric Oxide Synthase), TLR (Toll-like receptor) and 28S = 28S rRNA

Table 2: Experimental diets GM corn compositions for control and transgenic groups

Diet groups	Commercial diet	Non-GM corn seeds	CEMB-Bt corn seeds
Control	50%	50%	0%
T50	50%	0%	50%
T40	50%	10%	40%
T30	50%	20%	30%

Note: Commercial diet for broiler chicken purchased from local market

Fig. 1: Construct map transformed in to the CEMB Bt corn variety showing cry1Ac and cry2A genes

The concentration of Cry toxin in each diet formulation was revealed by using QuantiPlate for Cry1A & Cry2A Kit by Envirologix as per manual. Each sample was used in triplicate and OD was measured at 450 nm through SpectraMax® Plus 384 microplate reader with SoftNax Pro® software. The concentration of the bound Cry toxin was calculated by using the following formula:

Management of experimental birds and feeding trial

For the in-vitro feeding assay, 60 one-day old broiler chicks were procured by the courtesy of Sabir’s group, Faisalabad Road, Sheikhupura-Pakistan. All the chickens were vaccinated against New castle Disease (ND) at 8^th day. Later, at 30^th day, vaccination against infectious bursal disease was administered . The chickens were kept in a temperature controlled unit according to the protocol described by (Brake and Vlachos 1998). Further, incandescent lighting was provided for the first seven days of the experiment (Taylor et al. 2003). Chickens were kept at 32^oC and the temperature was gradually decreased to 24^oC until the completion of the trial. This trial was conducted in the month of February, 2019. Heaters were utilized to maintain the temperature of the chamber. The animals were kept in standard laboratory environments i.e., on floor covered with wooden shavings (Brake and Vlachos 1998). For each experimental group that was fed on control, T30, T40 and T50 diet formulations, 15 birds were randomly assigned to one group. The birds were fed for a period of 45 days.

Total feed and protein consumption

After completion of the 45-day feeding period, total feed consumed by each group was calculated. On the basis of feed consumption data was calculated and total Cry protein intake by each bird by using the following formula:

Total Cry protein intake by chicken (mg) =

Tissue sample collection for RNA isolation post feeding assay

Post 45-day feeding assay, blood and organ samples of birds were collected. Three birds were selected randomly from control and experimental groups for sampling. Blood was collected from the wing vein in Vacutainer (Rossi et al. 2005) for serum biochemistry. Total 3 mL blood was drawn from three animals per group and taken into the sterile serum separator tube. Blood samples were centrifuged at 3000 rpm for 10 min and serum was collected in new tubes and stored at 4^oC for further analysis. Tissue samples of the vital organs for RNA extraction were preserved in liquid nitrogen to preserve and were stored at -80^oC until use.

Serum biochemistry

Serum biochemistry was performed by the Diagnostic Lab., University of Veterinary and Animals Science, Lahore-Pakistan. The tests were liver function test (LFTs), AST (Aspartate aminotransferase), ALT (Alanine Aminotransferase), ALP (Alkaline Phosphatase) and total protein (TP) along with albumin and globulin. Levels of creatinine (CREA), Urea and Uric acid were also investigated for renal function test (RFTs).

Expression of immune and growth-related genes through Real-Time qPCR

The relative mRNA expression of selected marker genes for liver (cGH; chicken growth hormone gene, IGF-I & II; Insulin-like Growth Factor), spleen (interleukins; IL-2 and IL-β, iNOS; inducible Nitric Oxide Synthase, toll-like receptors; (TLR-05 and TLR-15) and intestine (mucin gene) was measured. For normalization, 28S rRNA was used as reference gene (Bhanja et al. 2014). The assays were performed in PikoReal PCR systems (Thermo Scientific). Primers sequences and details are depicted in the Table 1. For total RNA extraction from liver, spleen and intestine, the samples processed as described by Toni et al. (2018). A 100 mg tissue sample was taken from cryogenic vial and ground in liquid nitrogen for RNA isolation. Concentration of total RNA was measured by using NanoDrop (ND1000) by Biocompare. The cDNA was synthesized using Revertaid First strand cDNA synthesis kit (Thermo Scientific) as per manual. The mRNA expression of mucin, growth related and immune response genes from intestine, liver and spleen were revealed through qPCR. The reaction mixture comprised of 1 μM of each primer, 5.5 μL Maxima SYBR Green master mix (2X), 50 ng of cDNA and water (nuclease-free) to make up volume 10 μL. 28S rRNA gene was used as internal control for normalization. The real time PCR reaction conditions were denaturation at 95^oC for 3 min, 35 cycles of denaturation at 95^oC for 30 sec, annealing at 59^oC for 30 sec and extension at 72^oC for 30 sec. The gene expression data was analyzed using Livak method (Livak et al. 2013).

Statistical Analysis

All the data of the compositional diet analysis, various biochemical tests (LFTs and RFTs) and gene expression (growth and immune response genes) were subjected to statistical analysis and made comparison between the control and experimental groups. The mean and standard deviation of each replicate was calculated by using Microsoft Excel while 1-way ANOVA was applied by using Graph Pad Prism (version 5.00.288). The Post-test applied was Dunnet’s test if p>0.05 then values are non-significant and vice versa whereas “*” and “ns” representing the significant and non-signi ficant difference, respectively.

Results

Transgenes (cry1Ac/cry2A) insertion and protein concentration in CEMB-Bt Corn seeds

The transgenes cry1Ac/cry2A were amplified from the CEMB-Bt corn samples to confirm their insertion in the corn genome. It was found that a specific fragment of ~769bp was amplified in GM samples while no such amplification was observed in samples taken from the non-transgenic corn seeds (Fig. 2). The concentration of Cry2A + Cry1Ac protein in CEMB-Bt corn seeds present in diet formulations were 1.62, 1.32, 0.96 and 0 µg/gm in T50, T40, T30 and control group, respectively (Table 3).

Nutritional Analyses of diet fed to birds during feeding assay

The percentage of the dry matter, crude protein, crude fat, NFE starch+ soluble sugar and phosphorus were measured. The data confirmed that the nutritional composition of each of the four diet formulations (control, T30, T40, T50) didn’t exhibit any significant differences in dietary components among control and experimental groups (Table 4).

Total feed and Cry protein consumption

During the 45-day feeding trial, no significant difference was observed in feed consumed by subjected chicken in all four Table 3: Quantification of Cry1Ac and Cry2A protein in the GM corn seeds and experimental diets

	Transgenic corn (%)	Cry1Ac	Cry2A	Cry1Ac+Cry2A
GM corn Seeds	100%	1.4 µg/gm of seeds	1.82 µg/gm of seeds	2.22 µg/gm of seeds
Control (diet)	0%	0 µg/gm of diet	0 µg/gm of diet	0 µg/gm of diet
T50 (diet)	50%	0.70 µg/gm of diet	0.92 µg/gm of diet	1.62 µg/gm of diet
T40(diet)	40%	0.58 µg/gm of diet	0.74 µg/gm of diet	1.32 µg/gm of diet
T30 (diet)	30%	0.42 µg/gm of diet	0.54 µg/gm of diet	0.96 µg/gm of diet

Table 4: Nutritional Analyses of diet for each group

Components (%)	Treatments				p-value
Components (%)	Control	T50	T40	T30	p-value
Dry Matter	91.52±1.24	93.02±3.04	91.85±4.38	91.94±4.49	0.9571
Ash	3.84±0.96	3.97±1.19	3.81±1.13	3.84±0.37	0.9967
Crude Protein	12.20±1.37	13.40±0.71	12.80±1.67	12.83±1.37	0.7516
Crude Fat	1.74±0.23	1.63±0.34	1.67±0.25	1.68±0.26	0.9716
Crude Fiber	7.48±0.83	7.37±0.95	7.40±1.06	7.37±0.95	0.9987
NFE (%) Starch + Soluble Sugars	64.60±1.73	64.34±4.64	63.83±4.10	63.62±4.23	0.9882
Phosphorus	0.16±0.08	0.15±0.06	0.16±0.05	0.15±0.07	0.9955

Values in the table are the mean of the three replicates. Control, T50, T40 and T30 containing 0%, 50%, 40% and 30% GM corn respectively along 50% with commercial chicken feed. All nutritional values of control diet were non-significantly different with transgenic diet (p>0.05)

Table 5: Approximate intake of Bt protein by per animal of the groups

	A: (total protein) (µg/gm of diet)	B: Total feed consumption of Feed (kg)	Total protein intake per bird =
Control	0	57.85	0 mg
T50	1.62	56.36	6.09 mg
T40	1.32	58.36	5.14 mg
T30	0.96	56.95	3.64 mg

Table 6: Liver function parameters of control and transgenic groups

Liver function parameters	Treatments				p-Values
Liver function parameters	Control	T50	T40	T30	p-Values
AST (U/L)	290.00±58.85	294.00±61.61	280.33±29.19	281.33±57.01	0.9855
ALT (U/L)	21.00±2.00	21.00±3.46	21.00±1.00	20.67±2.08	0.9972
ALP (U/L)	2714.6±206.3	2715.3±95.0	2603.7±183.9	2757.3±236.7	0.7787
Total Protein (g/dL)	2.97±0.31	2.97±0.15	3.00±0.36	3.04±0.25	0.9875
Albumin (g/dL)	1.63±0.15	1.77±0.22	1.70±0.40	1.67±0.21	0.9237
Globulin g/dL	1.37±0.15	1.43±0.23	1.50±0.26	1.57±0.21	0.7048

Note: Liver function parameters (ALT, AST and ALP, total protein, Albumin, and Globulin) values were non-significant of control and transgenic groups (p>0.05; n=3)

groups. Specifically, the control group animals consumed about 57.85 kg of feed while the average feed consumed by T50, T40 and T30 group was 56.36, 58.36 and 56.95 kg, respectively. On the basis of the feed consumption and average Cry protein concentration in diet fed to bird groups control, T50, T40 and T30 group, the estimated Bt protein intake by each animal was 0 mg, 6.09, 5.14 and 3.64 mg, respectively (Table 5).

Serum biochemistry

Serum biochemistry analyses include LFTs (Liver function tests) and RFTs (Renal Function tests). For liver function test, no statistical difference between the values of enzymes expressed by liver; ALT, AST and ALP was found (p>0.05) (Table 6). Results of serum protein analysis parameters i.e., total protein, Albumin and Globulin were also in the normal range and showed non-significant difference among the values of the control and transgenic groups (p>0.05) as shown in Table 6. In renal function test, non-significant difference was observed between the values of Creatinine (CR) and Uric acid (UA) in different groups (p>0.05) as shown in Table 7.

Expression of mucin, growth-related and immune response genes

The mRNA expression of mucin, growth-related and immune response genes were analyzed using 2^(-ΔΔCt) Livak method. No significant difference was found in the relative gene expression among control and experimental group (p>0.05) as shown in the figures (Figs. 3, 4, 5) except

Fig. 2: Transgene (Bt) detection in GM and non-GM corn. L; 1kb DNA Ladder, 1; Non-GM Corn and 2; GM Corn, 3; positive Control

Fig. 3: Relative expression of Mucin gene related to intestinal tract development of control and transgenic corn fed groups chicken (p>0.05; n=3)

Fig. 4: Relative mRNA expression of chicken growth related gene (cGH; growth hormone IGF; Insuline like Growth Factor I and II). GH expression of control group is slightly low values and significant different to the transgenic groups (p<0.05; n=3). Expression of IGF-I and II gene shown no significant difference among control and transgenic groups (p<0.05; n=3)

Fig. 5: Relative expression of chicken immune related gene. Expression of IL-2, IL- β, TLR-04, TLR-15 and iNOS genes showed non-significant difference comparing to control and transgenic group (p>0.05; n=3)

cGH gene expression in control group that was recorded as slightly reduced and significantly differ from the transgenic groups (p<0.05).

Discussion

Agriculture has revolutionized by the transgenic crops in the recent years, however adaptation at commercial level require minimized biosafety concerns. In the present study, 45-day feeding trial of locally developed insect resistant CEMB-Bt corn on broiler chicken was performed and any potential effect of transgene on growth, development, immunity and serum chemistry of subjected bird is reported. In this study, we fed a defined concentration of the insecticidal Cry toxins (Cry1Ac and Cry2A) to broiler chicken that were divided in four different groups. Concentration of the transgenic protein in the diet was estimated through ELISA which is a common technique used for the quantification of the transgenic proteins in various crops (Bashir et al. 2005; Zhang et al. 2016).

Rigorous safety evaluation of a GM crop is warranted if the nutritional attributes has been significantly altered in transgenic line. Hence, to overcome this, we measured the nutritional composition of each diet prepared and found no significant difference when compared with control diet. Castillo et al. (2004) compared nutritional compositions of the diets with their considerable equivalences in a similar study. It has been reported from the previous study that B. thuringenesis derived insecticidal gene (cry1Ac) expressing insect resistance proteins could not change the dietary compositions of cotton (Tripathi et al. 2011). Few other studies have reported that the insertion of foreign DNA into plants did not alter the nutritional values of their seeds (Chrenková et al. 2002; Salisu et al. 2018). We also reported that the inclusion of transgenic corn in broiler chicken feed did not change the nutritional compositions when compared to the diet containing non-transgenic corn. Previous study also showed no significant difference was observed in the composition and nutrition analysis of Bt cotton (cry1Ac + cry2Ab2 gene) and non-Bt cotton seeds (Hamilton et al. 2004). Another study in which comprehensive compositional analysis of the transgenic corn (zmm28 gene) forage and corn was substantially equal to isogenic corn (Anderson et al. 2019).

It has been documented that chronic feeding of the GM feed might have more authentic outcome as compared to short term trials. We conducted 45 day feeding trial with mixed population of the broiler chickens which is comparable with others feeding bioassays conducted by (Řehout et al. (2009) on mixed population of broiler chickens fed Bt corn for 42 days. Another study performed in Poland on broiler chickens of mixed population fed Bt corn or RR soybean for 42 days (Reichert et al. 2012). A comparable feeding trial was performed with mixed population of broiler chicken through feeding of Bt sugarcane with commercial diet but the duration of feeding assay was 120 days (Hameed et al. 2016). In numerous studies mixed population of the broiler chicken were used in the studies for the comparison (Bashir et al. 2020; Onunkwo et al. 2021).

The serum biochemistry analysis reveals the liver and kidney functions (Harper 1971). Most of the serum proteins are generally produced in the liver and perform various tasks like maintenance of blood volume, hormonal transportation, metabolic regulation and providing protection against foreign invaders (Rezende et al. 2017). In current study, we measured serum biochemistry (LFTs, RFTs and lipid profile) parameters and found non-significant difference when compared to the control values. Řehout et al. (2009) conducted a feeding assay of Bt corn and found non-significant difference among control and treated birds for liver enzyme and total protein content of broiler chicken and fall within physiological range. In another study, broiler chickens fed on GM sugarcane (cry1Ac) exhibit non-significant difference in the ALT, AST, ALP, creatinine and urea (Hameed et al. 2016) among control and treatment groups.

The pathological process caused by any toxicant regulates the expression of number of genes including immunity associated genes. In the current study, feeding Bt corn did not cause any observable effects on splenic relative expression of selected genes IL-1β, IL-2, iNOS, TLR4 and TLR15 of the broiler chicken up to 50% along with commercial diet. We found relative reduced cGH gene expression that was significantly different (p<0.5) while non-significant difference was observed in relative mRNA expression of IGF-I and IGF-II genes among control and treated groups. Nutrient digestion and absorption is influenced by the Mucin which is major constituent of the mucus layer. Dietary components have the potential to induce changes in mucin dynamics. Higher expression of mucin gene triggered the number of goblet cells and production of acidic mucin in the GIT of a chick (Bhanja et al. 2014). We reported a non-significant difference in the relative expression of mucin gene among control and treated groups.

Conclusion

CEMB-Bt corn fed to broiler chicken in a 45 day long feeding trial didn’t exhibit any potential effect on growth and performance of subjected birds. Moreover, no statistically significant difference was observed in gene expression profile of specific growth related and immune responses in the chicken and no harmful effects were detected on monitoring the changes in specific biochemical parameters.

Acknowledgments

The authors acknowledge Pakistan Agricultural Research Board (PARB) for financial assistance under PARB Project No. 235.

Author Contributions

Zakiya Javed: Investigation. Fazeel Laraib: Investigation. Shafique Ahmed: Review and editing the draft. Arfan Ali: Helped in data interpretation. Bushra Tabassum: Validation. Abdul Munim Farooq: Resources. Muhammad Tariq: Data curation, original draft preparation. Asmatullah: Supervision. Idrees Ahmad Nasir: Supervision and Conceptualization.

Conflicts of Interests

No potential conflict of interest relevant to this article does exist.

Data Availability

All data has been presented in this article.

Ethics Approval

In this study, approved protocols were in accordance with the guidelines approved by the Institutional Animals Ethics committee of Center of Excellence in Molecular Biology, University of the Punjab, Lahore-Pakistan.

References

Anami M, I Widanarti (2020). Design and construction of corn sheller machine to the suitability of grain particle size for poultry feed raw materials. Musamus AE Featur J 2:52‒60

Anderson JA, B Hong, E Moellring, S TeRonde, C Walker, Y Wang, C Maxwell (2019). Composition of forage and grain from genetically modified DP202216 maize is equivalent to non-modified conventional maize (Zea mays L.). GM Crops Food 10:77‒89

Bashir K, T Husnain, T Fatima, N Riaz, R Makhdoom, S Riazuddin (2005). Novel indica basmati line (B-370) expressing two unrelated genes of Bacillus thuringiensis is highly resistant to two lepidopteran insects in the field. Crop Prot 24:870‒879

Bashir MK, M Ashraf, S Ur-Rehman, S Razzaq, MQ Bilal, S Mariam, M Tabbasum (2020). Effects of carica papaya leaf extract on blood hematology, serum biochemistry and immune response of broilers. Adv Life Sci 7:252‒256

Bhanja SK, M Sudhagar, A Goel, N Pandey, M Mehra, SK Agarwal, A Mandal (2014). Differential expression of growth and immunity related genes influenced by in ovo supplementation of amino acids in broiler chickens. Czech J Anim Sci 59:399‒408

Brake J, D Vlachos (1998). Evaluation of transgenic event 176 “Bt” corn in broiler chickens. Poult Sci 77:648‒653

Castillo AR, MR Gallardo, M Maciel, JM Giordano, GA Conti, MC Gaggiotti, O Quaino, C Gianni, GF Hartnell (2004). Effects of feeding rations with genetically modified whole cottonseed to lactating Holstein cows. J Dairy Sci 87:1778‒1785

Chrenková M, A Sommer, Z Čerešňáková, S Nitrayová, M Prostredná (2002). Nutritional evaluation of genetically modified maize corn performed on rats. Arch Anim Nutr 56:229‒235

Dona A, IS Arvanitoyannis (2009). Health risks of genetically modified foods. Crit Rev Food Sci Nutr 49:164‒175

Gabol WA, A Ahmed, H Bux, K Ahmed, A Mahar, S Laghari (2012). Genetically modified organisms (GMOs) in Pakistan. Afr J Biotechnol 11:2807‒2813

Graff GD, D Zilberman, AB Bennett (2009). The contraction of agbiotech product quality innovation. Nat Biotechnol 27:702‒704

Habib G, MFU Khan, S Javaid, M Saleem (2016). Assessment of feed supply and demand for livestock in Pakistan. J Agric Sci Technol A 6:191‒202

Hameed A, IA Nasir, B Tabassum, Z Qamar, M Zameer, M Younus, AQ Rao, B Rashid, M Tariq, GA Khan (2016). Biosafety assessment of locally developed transgenic sugarcane. J Anim Plant Sci 26:1124‒1132

Hamilton KA, PD Pyla, M Breeze, T Olson, M Li, E Robinson, SP Gallagher, R Sorbet, Y Chen (2004). Bollgard II cotton: Compositional analysis and feeding studies of cottonseed from insect-protected cotton (Gossypium hirsutum L.) producing the Cry1Ac and Cry2Ab2 proteins. J Agric Food Chem 52:6969‒6976

Harper H (1971). Review of Physiological Chemistry, 16^th edn. Lange Medical Books, New York, USA

Ibrahim MAA, EF Okasha (2016). Effect of genetically modified corn on the jejunal mucosa of adult male albino rat. Exp Toxicol Pathol 68:579‒588

Lee L-Y, SB Gelvin (2008). T-DNA binary vectors and systems. Plant Physiol 146:325‒332

Livak KJ, QF Wills, AJ Tipping, K Datta, R Mittal, AJ Goldson, DW Sexton, CC Holmes (2013). Methods for qPCR gene expression profiling applied to 1440 lymphoblastoid single cells. Methods 59:71‒79

Losey JE, LS Rayor, ME Carter (1999). Transgenic pollen harms monarch larvae. Nature 399:214

Mbabazi R, M Koch, K Maredia, J Guenthner (2021). Crop Biotechnology and Product Stewardship. GM Crop Food 12:106‒114

Miller JK, KJ Bradford (2010). The regulatory bottleneck for biotech specialty crops. Nat Biotechnol 28:1012‒1014

Napier JA, RP Haslam, M Tsalavouta, O Sayanova (2019). The challenges of delivering genetically modified crops with nutritional enhancement traits. Nat Plants 5:563‒567

Onunkwo DN, A Jabbar, M Talha, A Rauf, H Javaid, MU Munir, N Irm, MH Saleem (2021). Response of starter broiler chickens to feed diets treated with organic acids. Adv Life Sci 8:257‒261

Pellegrino E, S Bedini, M Nuti, L Ercoli (2018). Impact of genetically engineered maize on agronomic, environmental and toxicological traits: A meta-analysis of 21 years of field data. Sci Rep 8:1‒12

Řehout V, J Kadlec, J Čítek, E Hradecká, L Hanusová, B Hosnedlová, F Lád (2009). The influence of genetically modified Bt maize MON 810 in feed mixtures on slaughter, haematological and biochemical indices of broiler chickens. J Anim Feed Sci 18:490‒498

Reichert M, W Kozaczyński, TA Karpińska, Ł Bocian, A Jasik, A Kycko, M Świątkiewicz, S Świątkiewicz, I Furgał-Dierżuk, A Arczewska-Włosek (2012). Histopathology of internal organs of farm animals fed genetically modified corn and soybean meal. Bull Vet Inst Pulawy 56:617‒622

Rezende MS, AV Mundim, BB Fonseca, RL Miranda, W Oliveira, CG Lellis (2017). Profile of serum metabolites and proteins of broiler breeders in rearing age. Braz J Poult Sci 19:583‒586

Rossi F, M Morlacchini, G Fusconi, A Pietri, R Mazza, G Piva (2005). Effect of Bt corn on broiler growth performance and fate of feed-derived DNA in the digestive tract. Poult Sci 84:1022‒1030

Salisu IB, AA Shahid, Q Ali, AQ Rao, T Husnain (2018). Nutritional assessment of dietary Bt and CP4EPSPS proteins on the serum biochemical changes of rabbits at different developmental stages. Front Nutr 5:49

Sánchez MA, WA Parrott (2017). Characterization of scientific studies usually cited as evidence of adverse effects of GM food/feed. Plant Biotechnol J 15:1227‒1234

Taylor ML, Y Hyun, GF Hartnell, SG Riordan, MA Nemeth, K Karunanandaa, B George, JD Astwood (2003). Comparison of broiler performance when fed diets containing grain from YieldGard Rootworm (MON863), YieldGard Plus (MON810× MON863), nontransgenic control, or commercial reference corn hybrids. Poult Sci 82:1948‒1956

Toni LS, AM Garcia, DA Jeffrey, X Jiang, BL Stauffer, SD Miyamoto, CC Sucharov (2018). Optimization of phenol-chloroform RNA extraction. MethodsX 5:599‒608

Tripathi MK, D Mondal, R Somvanshi, SA Karim (2011). Haematology, blood biochemistry and tissue histopathology of lambs maintained on diets containing an insect controlling protein (Cry1Ac) in Bt‐cottonseed. J Anim Physiol Anim Nutr (Berl) 95:545‒555

Turnbull C, M Lillemo, TAK Hvoslef-Eide (2021). Global regulation of genetically modified crops amid the gene edited crop boom–a review. Front Plant Sci 12:258

Woolsey GL (2012). GMO timeline: A history of Genetically Modified Foods. GMO Inside, Washington DC, USA

Zhang Y, J Yang, J Nie, J Yang, D Gao, L Zhang, J Li (2016). Enhanced ELISA using a handheld pH meter and enzyme-coated microparticles for the portable, sensitive detection of proteins. Chem Commun 52:3474‒3477

Primers name

Primer Sequence 5' to 3'

Annealing temperature (oC)

Product size (bp)

Accession No.

Annealing temperature (^oC)